Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGAATGGCTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAAGACTGGCAAGCACGGCCACGCCAAGGTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATATGAAGATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAGCTGATTGGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAGGACCTTCGTCTCCCTGAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGAGAAGAGATCCTGATCACGGTGCTGTCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAACTGGCTCCCAGGGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... EIF5A(1984)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Peixun Han et al.
Cell reports, 31(5), 107610-107610 (2020-05-07)
Ribosome movement is not always smooth and is rather often impeded. For ribosome pauses, fundamental issues remain to be addressed, including where ribosomes pause on mRNAs, what kind of RNA/amino acid sequence causes this pause, and the physiological significance of
Polyamines Control eIF5A Hypusination, TFEB Translation, and Autophagy to Reverse B Cell Senescence.
Hanlin Zhang et al.
Molecular cell, 76(1), 110-125 (2019-09-03)
Failure to make adaptive immune responses is a hallmark of aging. Reduced B cell function leads to poor vaccination efficacy and a high prevalence of infections in the elderly. Here we show that reduced autophagy is a central molecular mechanism
Daniel J Puleston et al.
Cell metabolism, 30(2), 352-363 (2019-05-28)
How cells adapt metabolism to meet demands is an active area of interest across biology. Among a broad range of functions, the polyamine spermidine is needed to hypusinate the translation factor eukaryotic initiation factor 5A (eIF5A). We show here that