Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATGACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VCP(7415)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sevil Cayli et al.
Theriogenology, 158, 196-206 (2020-09-24)
p97/valosin-containing protein (VCP) is expressed in many cells and plays critical functions in a broad range of diverse cellular processes. Because it is expressed in the mouse testes, predominantly in Sertoli cells, and is known to play a critical role
Wallaya Phongphaew et al.
Virus research, 228, 114-123 (2016-12-05)
Valosin-containing protein (VCP) is classified as a member of the type II AAA
Katrin Schweitzer et al.
Journal of cellular and molecular medicine, 20(1), 58-70 (2015-10-16)
Cullin-RING-ubiquitin-ligase (CRL)-dependent ubiquitination of the nuclear factor kappa B (NF-κB) inhibitor IκBα and its subsequent degradation by the proteasome usually precede NF-κB/RelA nuclear activity. Through removal of the CRL-activating modification of their cullin subunit with the ubiquitin (Ub)-like modifier NEDD8