Skip to Content
Merck

EHU077321

MISSION® esiRNA

targeting human PTK2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTK2(5747)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Chang Liu et al.
Cancer medicine, 10(1), 337-349 (2020-12-07)
Lidocaine, one of the most commonly used local anesthetics during surgery, has been reported to suppress cancer cell growth via blocking voltage-gated sodium channels (VGSCs). VGSC 1.5 (NaV 1.5) is highly expressed in invasive cancers including ovarian cancer. This study
Qianfeng Zhuang et al.
Acta biochimica et biophysica Sinica, 50(5), 465-472 (2018-04-13)
Calpain small subunit 1 (Capn4) has been shown to correlate with the metastasis/invasion of clear cell renal cell carcinoma (ccRCC). This study aimed to further elucidate the molecular mechanisms underlying Capn4-mediated ccRCC progression. The mRNA expression levels in ccRCC cells
Pachiyappan Kamarajan et al.
PLoS pathogens, 16(10), e1008881-e1008881 (2020-10-02)
Epidemiological studies reveal significant associations between periodontitis and oral cancer. However, knowledge about the contribution of periodontal pathogens to oral cancer and potential regulatory mechanisms involved is limited. Previously, we showed that nisin, a bacteriocin and commonly used food preservative
Dariusz Lachowski et al.
Scientific reports, 7(1), 2506-2506 (2017-06-02)
Pancreatic Ductal Adenocarcinoma (PDAC) is an aggressive malignancy characterised by the presence of extensive desmoplasia, thought to be responsible for the poor response of patients to systemic therapies. Pancreatic stellate cells (PSCs) are key mediators in the production of this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service