Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGGACCAGCCTGATGAGAAGTCAAATGGAAAAAAAGCTAAAGGTCTTCAGTTTCTTTACTCTCCATGGTGGTGCCTGGCTGCTGCGACTCTAGGGGTCCTTTGCCTGGGATTAGTAGTGACCATTATGGTGCTGGGCATGCAATTATCCCAGGTGTCTGACCTCCTAACACAAGAGCAAGCAAACCTAACTCACCAGAAAAAGAAACTGGAGGGACAGATCTCAGCCCGGCAACAAGCAGAAGAAGCTTCACAGGAGTCAGAAAACGAACTCAAGGAAATGATAGAAACCCTTGCTCGGAAGCTGAATGAGAAATCCAAAGAGCAAATGGAACTTCACCACCAGAATCTGAATCTCCAAGAAACACTGAAGAGAGTAGCAAATTGTTCAGCTCCTTGTCCGCAAGACTGGATCTGGCATGGAGAAAACTGTTACCTATTTTCCTCGGGCTCATTTAACTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... OLR1(4973)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Tao Liu et al.
The Canadian journal of cardiology, 31(10), 1272-1281 (2015-06-23)
Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is a membrane protein associated with apoptosis. Endoplasmic reticulum (ER) stress-induced apoptosis has been determined in several cardiovascular diseases. Mitogen-activated protein kinase (MAPK) signalling is involved in apoptosis. The aim of this study was
Baonian Liu et al.
Biochemical and biophysical research communications, 508(4), 1113-1119 (2018-12-17)
Immune responses against antigens generally require an efficient activation of antigen-presenting cells (APCs). Currently, the targeting of vaccine antigens to APCs has emerged as a promising strategy for boosting vaccine immunogenicity. Here, we reported that the C-terminus of heat shock
Monica Villa et al.
Biochemical and biophysical research communications, 524(3), 696-701 (2020-02-09)
Inflammatory signals associated with cardiac diseases trigger trans-differentiation of cardiac fibroblasts to cardiac myofibroblasts. Cardiac myofibroblasts are the main cell type involved in the development of cardiac fibrosis, a diffuse and disproportionate accumulation of collagen in the myocardium. Although the