Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAACATGCCCAACAGACTTGTGAAGAATGTAGCACATTGTTTGGAGAATATTATTGCGATATATGCCATTTGTTTGACAAAGATAAGAAGCAGTATCACTGTGAAAACTGTGGAATTTGTAGGATTGGTCCAAAGGAAGATTTTTTCCATTGTTTGAAATGTAACTTATGCCTAGCTATGAATCTTCAAGGAAGACACAAGTGTATTGAAAATGTGTCCCGACAGAATTGTCCAATATGTTTGGAGGACATTCACACATCCCGTGTTGTTGCTCATGTCTTGCCATGTGGACATCTTTTACATAGAACGTGTTATGAAGAAATGTTGAAAGAAGGCTACAGATGTCCATTATGTATGCACTCTGCTTTAGATATGACCAGGTATTGGAGACAGCTGGATGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RCHY1(25898)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yifeng Bao et al.
Cellular and molecular neurobiology, 37(8), 1501-1509 (2017-03-05)
p53-induced protein with a RING-H2 domain (Pirh2), also known as Rchy1, is an ubiquitin E3 ligase that regulates the turnover and functionality of several proteins involved in cell proliferation and differentiation, cell cycle checkpoints, and cell death. However, it remains
Yang Yang-Hartwich et al.
Molecular cancer research : MCR, 17(1), 153-164 (2018-08-23)
Epithelial-mesenchymal transition (EMT) is a critical process involved in cancer metastasis and chemoresistance. Twist1 is a key EMT-inducing transcription factor, which is upregulated in multiple types of cancers and has been shown to promote tumor cell invasiveness and support tumor
Mina Choi et al.
Biochemical and biophysical research communications, 521(1), 37-41 (2019-10-22)
HDAC2, one of the class I histone deacetylase regulates epigenetic landscape through histone modification. Because HDAC2 is overexpressed in many cancers, cancer therapeutics against HDAC2 have been developed. Here we show novel mechanism of HDAC2 regulation by E3 ligase RCHY1.