Skip to Content
Merck

EHU128201

MISSION® esiRNA

targeting human DEPDC1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGCCATCGATGCTCTACAGTTATGTTGTTTGTTACTTCCCCCACCAAATCGTAGAAAGCTTCAACTTTTAATGCGTATGATTTCCCGAATGAGTCAAAATGTTGATATGCCCAAACTTCATGATGCAATGGGTACGAGGTCACTGATGATACATACCTTTTCTCGATGTGTGTTATGCTGTGCTGAAGAAGTGGATCTTGATGAGCTTCTTGCTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DEPDC1(55635)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Alboukadel Kassambara et al.
PloS one, 8(4), e62752-e62752 (2013-05-07)
High throughput DNA microarray has made it possible to outline genes whose expression in malignant plasma cells is associated with short overall survival of patients with Multiple Myeloma (MM). A further step is to elucidate the mechanisms encoded by these
Anna Tosi et al.
Oncoimmunology, 6(8), e1313371-e1313371 (2017-09-19)
The identification of universal tumor-specific antigens shared between multiple patients and/or multiple tumors is of great importance to overcome the practical limitations of personalized cancer immunotherapy. Recent studies support the involvement of DEPDC1 in many aspects of cancer traits, such
Ryogo Kikuchi et al.
Journal of neuro-oncology, 133(2), 297-307 (2017-05-31)
DEP domain containing 1 (DEPDC1) is a novel oncoantigen expressed in cancer cells, which presents oncogenic activity and high immunogenicity. Although DEPDC1 has been predicted to be a useful antigen for the development of a cancer vaccine, its pathophysiological roles