Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCATACTGGGAGGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAGCCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATGGCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCAGCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATCCAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGACAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTCCCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGTACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCAGCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SMAD7(4092)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ratana Lim et al.
Biology of reproduction, 97(2), 288-301 (2017-10-19)
Preterm birth continues to be a significant public health problem. Infection (bacterial and or viral) and inflammation, by stimulating proinflammatory cytokines, adhesion molecules, and matrix metalloproteinase 9 (MMP9), play a central role in the rupture of membranes and myometrial contractions.
Takashi Emori et al.
Biology open, 1(3), 247-260 (2012-12-06)
Smad family proteins are essential intracellular mediators that regulate transforming growth factor-β (TGF-β) ligand signaling. In response to diverse stimuli, Smad7 is rapidly expressed and acts as a cytoplasmic inhibitor that selectively interferes with signals elicited from TGF-β family receptors.
R B Luwor et al.
Oncogene, 32(19), 2433-2441 (2012-07-04)
Transforming Growth Factor-β (TGF-β) and Epidermal Growth Factor (EGF) signaling pathways are both independently implicated as key regulators in tumor formation and progression. Here, we report that the tumor-associated overexpression of epidermal growth factor receptor (EGFR) desensitizes TGF-β signaling and