Skip to Content
Merck

EHU062481

MISSION® esiRNA

targeting human MAPK3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAPK3(5595)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Nicolas Ricard et al.
Cells, 9(1) (2019-12-28)
Despite the clinical importance of arteriogenesis, this biological process is poorly understood. ERK1 and ERK2 are key components of a major intracellular signaling pathway activated by vascular endothelial growth (VEGF) and FGF2, growth factors critical to arteriogenesis. To investigate the
Wei Chen et al.
Cell & bioscience, 7, 43-43 (2017-08-31)
Connexins are a family of transmembrane proteins that form gap junctions, which are important for diffusion of cytosolic factors such as ions and second messenger signaling molecules. Our previous study has shown that Connexin40 (Cx40), one dominant connexin expressed in
Osamu Otabe et al.
Oncology reports, 37(1), 98-104 (2016-11-15)
In alveolar rhabdomyosarcoma (ARMS) that is a highly malignant pediatric soft tissue tumor, MET, a receptor of hepatocyte growth factor (HGF), was reported to be downstream of the PAX3-FOXO1 fusion gene specific to ARMS, and a key mediator of metastatic