Skip to Content
Merck

EHU092951

MISSION® esiRNA

targeting human CREB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CREB1(1385)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



L Yuan et al.
Neuropathology and applied neurobiology, 42(7), 607-620 (2015-11-04)
14,15-Epoxyeicosatrienoic acid (14,15-EET) is abundantly expressed in brain and exerts protective effects against ischaemia. 14,15-EET is hydrolysed by soluble epoxide hydrolase (sEH). sEH-/- mice show a higher level of 14,15-EET in the brain. Astrocytes play a pivotal role in neuronal
Supriya Srinivasan et al.
Cancer research, 78(21), 6146-6158 (2018-09-21)
Although smoking is a significant risk factor for pancreatic ductal adenocarcinoma (PDAC), the molecular mechanisms underlying PDAC development and progression in smokers are still unclear. Here, we show the role of cyclic AMP response element-binding protein (CREB) in the pathogenesis
Hui-Xia Geng et al.
Neurochemical research, 42(10), 2841-2849 (2017-05-17)
Neuronal apoptosis mediated by the mitochondrial apoptosis pathway is an important pathological process in cerebral ischemia-reperfusion injury. 14,15-EET, an intermediate metabolite of arachidonic acid, can promote cell survival during ischemia/reperfusion. However, whether the mitochondrial apoptotic pathway is involved this survival