Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAAACCTACCACCGGACACGTGCTTTAAGATCTTTGAGAAAAGATGCACAGAATTCTTCAGATTCTAGTTTTGAGAAGAATGTGGAAATAACGGAGCAACTTGCTAATGGCAGGCATTTTACAAGGCAGTTGGCCAGACAGCAGGCTGATAAAAAAAAAGAAGAGCACAGAGAAGACAAAGTGATTCCAGTTACTCGGTCATTGAGGGCTAGAAACATCGTTCAAAGTACAGAACACTTACATGAAGATAATGGTGATGTTGAAGTGCGTCGAAGTTGTAGGATTAGAAGTCGTTATAGTGGTGTAAACCAGTCCATGCTGTTTGACAAACTTATAACTAACACTGCTGAAGCTGTACTTCAAAAAATGGATGACATGAAGAAGATGCGTAGACAGCGAATGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ATAD2(29028)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
S Hong et al.
Neoplasma, 63(6), 846-855 (2016-08-28)
Colorectal cancer is one of the most common malignant tumors with a high rate of distant metastasis, postoperative recurrence and mortality. ATPase family AAA domain-containing protein 2 (ATAD2), a member of ATPase family, is highly expressed in various cancers, including
Xuan Zhou et al.
Cancer management and research, 12, 337-351 (2020-02-06)
The aim of the present study was to examine the expression of ATAD2 in gastric cancer (GC) specimens and to evaluate its correlation with clinicopathologic features, including survival of GC patients. The potential roles of ATAD2 in the GC cell
J-H Wang et al.
European review for medical and pharmacological sciences, 24(11), 6055-6063 (2020-06-24)
This study aims to clarify the potential function of ATAD2 (ATPase family, AAA domain containing 2) in regulating proliferative and apoptotic abilities of colorectal carcinoma (CRC). ATAD2 levels in CRC specimens and cell lines were detected by quantitative Real Time-Polymerase