Skip to Content
Merck

EHU121691

MISSION® esiRNA

targeting human ATAD2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAACCTACCACCGGACACGTGCTTTAAGATCTTTGAGAAAAGATGCACAGAATTCTTCAGATTCTAGTTTTGAGAAGAATGTGGAAATAACGGAGCAACTTGCTAATGGCAGGCATTTTACAAGGCAGTTGGCCAGACAGCAGGCTGATAAAAAAAAAGAAGAGCACAGAGAAGACAAAGTGATTCCAGTTACTCGGTCATTGAGGGCTAGAAACATCGTTCAAAGTACAGAACACTTACATGAAGATAATGGTGATGTTGAAGTGCGTCGAAGTTGTAGGATTAGAAGTCGTTATAGTGGTGTAAACCAGTCCATGCTGTTTGACAAACTTATAACTAACACTGCTGAAGCTGTACTTCAAAAAATGGATGACATGAAGAAGATGCGTAGACAGCGAATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATAD2(29028)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



S Hong et al.
Neoplasma, 63(6), 846-855 (2016-08-28)
Colorectal cancer is one of the most common malignant tumors with a high rate of distant metastasis, postoperative recurrence and mortality. ATPase family AAA domain-containing protein 2 (ATAD2), a member of ATPase family, is highly expressed in various cancers, including
Xuan Zhou et al.
Cancer management and research, 12, 337-351 (2020-02-06)
The aim of the present study was to examine the expression of ATAD2 in gastric cancer (GC) specimens and to evaluate its correlation with clinicopathologic features, including survival of GC patients. The potential roles of ATAD2 in the GC cell
J-H Wang et al.
European review for medical and pharmacological sciences, 24(11), 6055-6063 (2020-06-24)
This study aims to clarify the potential function of ATAD2 (ATPase family, AAA domain containing 2) in regulating proliferative and apoptotic abilities of colorectal carcinoma (CRC). ATAD2 levels in CRC specimens and cell lines were detected by quantitative Real Time-Polymerase