Skip to Content
Merck

EHU009051

MISSION® esiRNA

targeting human DDIT4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DDIT4(54541)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Bowen Wang et al.
Investigative ophthalmology & visual science, 60(8), 2836-2847 (2019-07-03)
To assess how DNA damage-inducible transcript 4 (DDIT4) and autophagic flux are altered in dry eye disease and reveal the underlying mechanisms. C57BL/6 mice were exposed to desiccating stress (subcutaneous scopolamine [0.5 mg/0.2 mL] 3 times a day, humidity <
Aistė Savukaitytė et al.
Cancer management and research, 13, 1123-1133 (2021-02-13)
Mutations within genes encoding components of the PI3K/AKT/mTOR (phosphoinositide 3-kinase/protein kinase B/mechanistic target of rapamycin) signaling axis frequently activate the pathway in breast cancer, making it an attractive therapeutic target. Inhibition of mTORC1 (mechanistic target of rapamycin complex 1) activity
Peng Li et al.
Biochemical and biophysical research communications, 519(1), 179-185 (2019-09-09)
Oxidative stress plays a significant role involved in myocardial ischemia/reperfusion (MI/R) injury. The regulated in development and DNA damage response 1 (REDD1) is an mTORC1 inhibitor participating in response to hypoxia and oxidative stress. However, whether and how REDD1 is