Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MYC(4609)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Juanjuan Liu et al.
Annals of biomedical engineering, 45(6), 1407-1419 (2017-03-30)
Melanoma is a potentially lethal skin cancer with high mortality rate. Recently, the peptide-mediated transdermal delivery of small interference RNA (siRNA) emerges as a promising strategy to treat melanoma by inducing the apoptosis of tumor cells, but the related theoretical
Yili Tao et al.
Scientific reports, 8(1), 14477-14477 (2018-09-29)
Colorectal cancer (CRC) is among the most frequently occurring cancers worldwide. Baicalin is isolated from the roots of Scutellaria baicalensis and is its dominant flavonoid. Anticancer activity of baicalin has been evaluated in different types of cancers, especially in CRC.
Xuyang Wang et al.
World journal of gastroenterology, 23(18), 3252-3261 (2017-06-02)
To determine the role of hepatitis B virus X protein (HBx), HBx in regulating hepatic progenitor cell (HPC)-like features in hepatocellular carcinoma (HCC) and the underlying molecular mechanisms. We used a retrovirus vector to introduce wild type HBx or empty