Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAGACCTGCCTTCTCATCAGCTACACCACCAACGCCTTTCCCGGAGAGTACATCCCCACCGTGTTTGACAACTATTCAGCCAATGTGATGGTGGACAGCAAGCCAGTGAACCTGGGGCTGTGGGACACTGCTGGGCAGGAGGACTACGACCGTCTCCGGCCGCTCTCCTATCCACAGACGGACGTCTTCCTCATCTGCTTCTCCCTCGTCAGCCCAGCCTCTTATGAGAACGTCCGCGCCAAGTGGTTCCCAGAAGTGCGGCACCACTGCCCCAGCACACCCATCATCCTGGTGGGCACCAAGCTGGACCTGCGGGACGACAAGGACACCATCGAGAAACTGAAGGAGAAGAAGCTGGCTCCCATCACCTACCCGCAGGGCCTGGCACTGGCCAAGGAGATTGACTCGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAC2(5880)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hailong Pei et al.
Cell cycle (Georgetown, Tex.), 16(1), 113-122 (2016-12-10)
Our recent study showed that quiescent G0 cells are more resistant to ionizing radiation than G1 cells; however, the underlying mechanism for this increased radioresistance is unknown. Based on the relatively lower DNA damage induced in G0 cells, we hypothesize
Peng Xia et al.
International journal of biological macromolecules, 137, 1221-1231 (2019-07-07)
Osteosarcoma (OS) is the most common primary malignancy of bone and is characterized by a high malignant and metastatic potential. Microarray-based differentially expressed gene screening determined RAC2 as the candidate gene related to OS. Highly expressed RAC2 and activated Wnt
Xu Zhang et al.
Cancer medicine, 8(12), 5716-5734 (2019-08-08)
The aim of this study is to investigate the functions and mechanisms of miR-608 in prostate cancer (PCa). CISH and qRT-PCR analysis demonstrated that miR-608 was low expressed in PCa tissues and cells, which was partly attributed to the methylation