Skip to Content
Merck

EHU012281

MISSION® esiRNA

targeting human CLEC14A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCTGGGACAAACTCTCGGGCGATGTGTTGTGTCCCTGCCCCGGGAGGTACCTCCGTGCTGGCAAATGCGCAGAGCTCCCTAACTGCCTAGACGACTTGGGAGGCTTTGCCTGCGAATGTGCTACGGGCTTCGAGCTGGGGAAGGACGGCCGCTCTTGTGTGACCAGTGGGGAAGGACAGCCGACCCTTGGGGGGACCGGGGTGCCCACCAGGCGCCCGCCGGCCACTGCAACCAGCCCCGTGCCGCAGAGAACATGGCCAATCAGGGTCGACGAGAAGCTGGGAGAGACACCACTTGTCCCTGAACAAGACAATTCAGTAACATCTATTCCTGAGATTCCTCGATGGGGATCACAGAGCACGATGTCTACCCTTCAAATGTCCCTTCAAGCCGAGTCAAAGGCCACTATCACCCCATCAGGGAGCGTGATTTCCAAGTTTAATTCTACGACTTCCTCTGCCACTCCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CLEC14A(161198)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Sungwoon Lee et al.
The Journal of clinical investigation, 127(2), 457-471 (2016-12-20)
Controlled angiogenesis and lymphangiogenesis are essential for tissue development, function, and repair. However, aberrant neovascularization is an essential pathogenic mechanism in many human diseases, including diseases involving tumor growth and survival. Here, we have demonstrated that mice deficient in C-type
Yeomyeong Kim et al.
Journal of neuroinflammation, 17(1), 48-48 (2020-02-06)
Ischemic stroke is a main cause of mortality. Blood-brain barrier (BBB) breakdown appears to play a critical role in inflammation in patients with ischemic stroke and acceleration of brain injury. The BBB has a protective function and is composed of
P J Noy et al.
Oncogene, 34(47), 5821-5831 (2015-03-10)
We previously identified CLEC14A as a tumour endothelial marker. Here we show that CLEC14A is a regulator of sprouting angiogenesis in vitro and in vivo. Using a human umbilical vein endothelial cell spheroid-sprouting assay, we found CLEC14A to be a