Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGGAAAGATGTCGAGGAAGTAAGTTGTATAGAAACACAGGACAATCAGAACTCAGAAGGAGAGGCAAGAAATTGCTGTGAAACATCTATCAGACAGGACTCTGATTCATCAGTTTCAGACAAACAGCGGCAAACCATCATTATTGCCGACTCCCCGAGTCCTGCAGTGAGTGTCATCACTATCAGCAGTGACACTGATGAGGAAGAGACTTCCCAGAGACATTCACTCAGAGAATGTAAAGGTAGTCTAGATTGTGAAGCTTGCCAGAGCACTTTGAATATTGATCGGATGTGTTCATTAAGTAGTCCTGATAGTACTCTGAGTACCAGCTCCTCAGGGCAGTCCAGCCCATCCCCCTGCAAGAGACCGAATAGTATGTCAGATGAAGAGCAAGAAAGTAGTTGTGATACGGTGGATGGCTCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HIPK3(10114)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
X Q Feng et al.
Neoplasma, 67(1), 171-177 (2019-07-17)
Increasing evidence demonstrate that circular RNAs (circRNAs) play critical role in regulation of gene expression, which participate in the pathogenesis of cancer, including chronic myeloid leukemia (CML). In this study, we aimed to investigate the expression profiling of circHIPK3 in
Junling Lin et al.
Life sciences, 255, 117835-117835 (2020-05-26)
Emerging findings demonstrate the critical roles of noncoding RNA (ncRNA) in asthma development. Nevertheless, the biological roles of circular RNA (circRNA) in airway remodeling are still elusive. Here, the present research focuses on the regulation of circRNA circHIPK3 in airway
Zhongyue Huang et al.
BioMed research international, 2020, 2727060-2727060 (2020-08-11)
Recent studies have suggested that circular RNAs play an important role in the progression of various cancers. However, few studies have revealed the great value of circRNAs in the diagnosis and prognosis prediction of osteosarcoma (OS). In this study, we