Skip to Content
Merck

EHU020331

MISSION® esiRNA

targeting human IRS1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCCCAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGACAAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAGCAGCGGTGGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGCAGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCATTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGCATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRS1(3667)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Yongxin Luan et al.
International journal of clinical and experimental pathology, 8(9), 10345-10354 (2015-12-01)
MicroRNA (miR-126) was reported to be downregulated and to act as a tumor suppressor in cancers of the lung, cervix, bladder, breast, liver and prostate. However, the precise roles and underling mechanisms of miR-126 in glioma remain largely unknown. This
Peng Wang et al.
Technology in cancer research & treatment, 16(6), 1102-1112 (2018-01-16)
Thyroid cancer is a common endocrine gland malignancy which exhibited rapid increased incidence worldwide in recent decades. This study was aimed to investigate the role of long noncoding RNA H19 in thyroid cancer. Long noncoding RNA H19 was overexpressed or
Y Chen et al.
European review for medical and pharmacological sciences, 23(18), 7989-7999 (2019-10-11)
The important role of microRNA-1271 (miR-1271) has been identified in human diseases and cancers. However, the biological function of miR-1271 remains ambiguous in papillary thyroid carcinoma (PTC). Therefore, the specific role of miR-1271 was investigated in PTC. The expressions of