Skip to Content
Merck

EHU024031

MISSION® esiRNA

targeting human SP3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTCCTGGTCAAACCCAAGTAGTTGCTAATGTGCCTCTTGGTCTGCCAGGAAATATTACGTTTGTACCAATCAATAGTGTCGATCTAGATTCTTTGGGACTCTCGGGCAGTTCTCAGACAATGACTGCAGGCATTAATGCCGACGGACATTTGATAAACACAGGACAAGCTATGGATAGTTCAGACAATTCAGAAAGGACTGGTGAGCGGGTTTCTCCTGATATTAATGAAACTAATACTGATACAGATTTATTTGTGCCAACATCCTCTTCATCACAGTTGCCTGTTACGATAGATAGTACAGGTATATTACAACAAAACACAAATAGCTTGACTACATCTAGTGGGCAGGTTCATTCTTCAGATCTTCAGGGAAATTATATCCAGTCGCCTGTTTCTGAAGAGACACAGGCACAGAATATTCAGGTTTCTACAGCACAGCCTGTTGTACAGCATCTACAACTTCAAGAGTCTCAGCAGCCAACCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SP3(6670)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yinxian Wen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12834-12846 (2020-08-09)
Maternal dexamethasone decreases the body length of the newborn. However, whether dexamethasone inhibits the development of the growth plate of the fetal long bone is still unknown. Here, we found that lengths of fetal femur and growth plate were both
Yan-Yan Xu et al.
Scientific reports, 7(1), 2090-2090 (2017-05-20)
Stimulator of Interferon Gene (STING) is a key mediator of innate immune signaling. STING plays a pivotal role in the pathogenesis of many diseases including infectious diseases, auto-immune diseases and cancer. Many studies have been carried out recently in the
Shawn T Beug et al.
Science signaling, 12(566) (2019-01-31)
The controlled production and downstream signaling of the inflammatory cytokine tumor necrosis factor-α (TNF-α) are important for immunity and its anticancer effects. Although chronic stimulation with TNF-α is detrimental to the health of the host in several autoimmune and inflammatory