Skip to Content
Merck

EHU024131

MISSION® esiRNA

targeting human KCNN1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCAGCATCTCCTCCTGGATCATCGCAGCCTGGACCGTGCGCGTCTGCGAGAGGTACCACGACAAGCAGGAAGTGACCAGCAACTTCCTGGGGGCCATGTGGCTGATTTCCATCACCTTCCTCTCCATTGGCTACGGCGACATGGTGCCCCACACCTACTGCGGGAAGGGTGTGTGCCTGCTCACTGGCATCATGGGAGCTGGCTGTACCGCGCTCGTGGTGGCTGTGGTGGCTCGGAAGCTGGAGCTCACCAAGGCTGAGAAGCACGTGCACAACTTCATGATGGACACTCAGCTCACCAAGCGGGTAAAAAACGCCGCTGCTAACGTTCTCAGGGAGACGTGGCTCATCTACAAACATACCAGGCTGGTGAAGAAGCCAGACCAAGCCCGGGTTCGGAAACACCAGCGTAAGTTCCTCCAAGCCATCCATCATGGCAGGATGCTCCGGAGTGTGAAGATCGAGCAAGGGAAGCTGAACGACCAGGCTAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KCNN1(3780)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Young-Jin Seo et al.
PloS one, 8(8), e75005-e75005 (2013-10-19)
Influenza continues to pose a threat to humans by causing significant morbidity and mortality. Thus, it is imperative to investigate mechanisms by which influenza virus manipulates the function of host factors and cellular signal pathways. In this study, we demonstrate
Heba Alshaker et al.
Frontiers in pharmacology, 10, 303-303 (2019-04-12)
Sphingosine kinases 1 and 2 (SK1 and SK2) are proto-oncogenic isozymes expressed in many human tumors and associated with chemoresistance and poor prognosis. They are well-recognized therapy targets and their inhibition was shown to induce tumor volume reduction and chemosensitization
Ilari Pulli et al.
Biochimica et biophysica acta, 1853(9), 2173-2182 (2015-04-22)
Caveolae are plasma membrane invaginations enriched in sterols and sphingolipids. Sphingosine kinase 1 (SK1) is an oncogenic protein that converts sphingosine to sphingosine 1-phosphate (S1P), which is a messenger molecule involved in calcium signaling. Caveolae contain calcium responsive proteins, but