Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGCAGTCCGTAACATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGTGGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGGCTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCATGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCGGCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STIM1(6786)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan-Yang Mao et al.
Biochemical and biophysical research communications, 505(1), 119-125 (2018-09-23)
The prevention and treatment of coronary heart disease (CHD) is a difficult problem to be solved. More and more studies have found that circular RNAs (circRNAs) may play important roles in the development of CHD. Here detection of vascular smooth
Yadong Wang et al.
Oncotarget, 7(52), 86584-86593 (2016-11-20)
This study aimed to address the potential role of STIM1 (stromal interaction molecule 1) in lung tumorigenesis. Colony formation in soft agar assay and tumorigenicity in nude mice assay were conducted. Western blot, immunohistochemistry and quantitative real-time polymerase chain reaction
Dongyu Wei et al.
Frontiers in cellular neuroscience, 11, 400-400 (2018-01-10)
Store-operated calcium channels (SOCs) are highly calcium-selective channels that mediate calcium entry in various cell types. We have previously reported that intraplantar injection of YM-58483 (a SOC inhibitor) attenuates chronic pain. A previous study has reported that the function of