Skip to Content
Merck

EHU026451

MISSION® esiRNA

targeting human ORMDL3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGAGAGTGCAGCCCCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ORMDL3(94103)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Weixia Yang et al.
Aging, 11(9), 2787-2796 (2019-05-08)
Endoplasmic reticulum (ER) stress in beta cells induces a signaling network called the unfolded protein response (UPR), which plays a dual role in diabetes. A key regulator of ER-stress and UPR, the orosomucoid 1-like protein 3 (ORMDL3), has been shown
Youming Zhang et al.
American journal of respiratory and critical care medicine, 199(4), 478-488 (2018-10-20)
Polymorphisms on chromosome 17q21 confer the major genetic susceptibility to childhood-onset asthma. Risk alleles positively correlate with ORMDL3 (orosomucoid-like 3) expression. The locus influences disease severity and the frequency of human rhinovirus (HRV)-initiated exacerbations. ORMDL3 is known to regulate sphingolipid
Yiping Liu et al.
American journal of respiratory cell and molecular biology, 62(6), 783-792 (2020-02-23)
Polymorphism at the 17q21 gene locus and wheezing responses to rhinovirus (RV) early in childhood conspire to increase the risk of developing asthma. However, the mechanisms mediating this gene-environment interaction remain unclear. In this study, we investigated the impact of