Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGAGAGTGCAGCCCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ORMDL3(94103)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Weixia Yang et al.
Aging, 11(9), 2787-2796 (2019-05-08)
Endoplasmic reticulum (ER) stress in beta cells induces a signaling network called the unfolded protein response (UPR), which plays a dual role in diabetes. A key regulator of ER-stress and UPR, the orosomucoid 1-like protein 3 (ORMDL3), has been shown
Youming Zhang et al.
American journal of respiratory and critical care medicine, 199(4), 478-488 (2018-10-20)
Polymorphisms on chromosome 17q21 confer the major genetic susceptibility to childhood-onset asthma. Risk alleles positively correlate with ORMDL3 (orosomucoid-like 3) expression. The locus influences disease severity and the frequency of human rhinovirus (HRV)-initiated exacerbations. ORMDL3 is known to regulate sphingolipid
Yiping Liu et al.
American journal of respiratory cell and molecular biology, 62(6), 783-792 (2020-02-23)
Polymorphism at the 17q21 gene locus and wheezing responses to rhinovirus (RV) early in childhood conspire to increase the risk of developing asthma. However, the mechanisms mediating this gene-environment interaction remain unclear. In this study, we investigated the impact of