Skip to Content
Merck

EHU033791

MISSION® esiRNA

targeting human MIB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTGCAGATTGGTGACCTGGTAAATATAGATCTCGACCTCGAAATTGTACAGTCTTTGCAGCATGGTCATGGAGGATGGACTGATGGAATGTTTGAGACTTTAACTACAACTGGAACTGTTTGTGGCATTGATGAAGATCATGACATTGTAGTACAGTATCCAAGTGGCAATAGGTGGACCTTCAATCCTGCTGTTCTCACTAAAGCGAACATTGTCCGAAGTGGAGATGCTGCTCAGGGTGCAGAAGGAGGCACCTCGCAGTTTCAAGTGGGTGATCTTGTACAAGTTTGTTATGACCTGGAACGAATTAAACTTCTACAAAGAGGACATGGAGAATGGGCTGAAGCGATGCTTCCAACTTTAGGTAAAGTTGGCCGAGTACAACAGATTTATTCAGACAGTGATTTAAAGGTGGAAGTTTGTGGAACATCTTGGACATACAATCCAGCAGCAGTTTCCAAGGTGGCATCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MIB1(57534)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yoshihiro Otani et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(10), 2381-2392 (2020-03-07)
To examine the effect of oncolytic herpes simplex virus (oHSV) on NOTCH signaling in central nervous system tumors. Bioluminescence imaging, reverse phase protein array proteomics, fluorescence microscopy, reporter assays, and molecular biology approaches were used to evaluate NOTCH signaling. Orthotopic
Osamu Nakabayashi et al.
Communications biology, 4(1), 80-80 (2021-01-21)
Mind bomb 2 (MIB2) is an E3 ligase involved in Notch signalling and attenuates TNF-induced apoptosis through ubiquitylation of receptor-interacting protein kinase 1 (RIPK1) and cylindromatosis. Here we show that MIB2 bound and conjugated K48- and K63-linked polyubiquitin chains to
Marissa A Scavuzzo et al.
Cell reports, 25(13), 3811-3827 (2018-12-28)
Notch is activated globally in pancreatic progenitors; however, for progenitors to differentiate into endocrine cells, they must escape Notch activation to express Neurogenin-3. Here, we find that the transcription factor nuclear factor I/A (NFIA) promotes endocrine development by regulating Notch