Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAACCAGGAAAGACCACAGCCGATTTGGCATTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGGGATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTCGAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATGTTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTTTTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGACAAAGACAGTTTCTTCACTTGAGCCCTTAAAAAAGTAACCACTATAAAGGTTTCACGCGGTGGGTTCTTATTGATTCGCTGTGTCATCACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FGF9(2254)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhijin Zhang et al.
Experimental and therapeutic medicine, 19(3), 1711-1718 (2020-02-28)
Development of cisplatin resistance in colorectal cancer is largely caused by dysregulation of signaling pathways, including the Wnt/β-catenin signaling pathway, in cancer cells. Further investigation into the molecular mechanism of chemoresistance could improve outcomes for patients with colorectal cancer. The
Longhao Li et al.
Biology open, 9(5) (2020-05-06)
Tumor metastasis is the main contributor to high recurrence and mortality in colorectal cancer (CRC). In a previous study, we found that DJ-1 plays an important role in CRC metastasis, and is the main target in Ciclopirox olamine (CPX)-treated CRC.
Wei Wang et al.
Oncology letters, 19(1), 1001-1007 (2020-01-04)
Breast cancer has become an important public health problem. Moreover, the functions of microRNA-431 (miR-431) have been detected in human cancers other than breast cancer. Hence, we investigated the role of miR-431 in progression of breast cancer. RT-qPCR and Western