Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCACTGAGTCATGCGACTTCGTGCGGGCCATGGTGGACCCGGCCCAGACGGTGGAACAGAGGCTGAAGTTGTTCAAGTTGGCGTCTGAGAAGCATCAGCATATGTATCGCCTCGCCATGACCGGCTCTGGGATCGATCGTCACCTCTTCTGCCTTTACGTGGTGTCTAAATATCTCGCTGTGGAGTCCCCTTTCCTTAAGGAAGTTTTATCTGAGCCTTGGAGATTATCAACAAGCCAGACCCCTCAGCAGCAAGTGGAGCTGTTTGACTTGGAGAATAACCCAGAGTACGTGTCCAGCGGAGGGGGCTTTGGACCGGTTGCTGATGACGGCTATGGTGTGTCGTACATCCTTGTGGGAGAGAACCTCATCAATTTCCACATTTCTTCCAAGTTCTCTTGCCCTGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CPT1A(1374)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Seher Balaban et al.
Molecular cancer research : MCR, 17(4), 949-962 (2019-01-17)
Prostate cancer cells exhibit altered cellular metabolism but, notably, not the hallmarks of Warburg metabolism. Prostate cancer cells exhibit increased de novo synthesis of fatty acids (FA); however, little is known about how extracellular FAs, such as those in the
Hideki Iwamoto et al.
Cell metabolism, 28(1), 104-117 (2018-06-05)
Intrinsic and evasive antiangiogenic drug (AAD) resistance is frequently developed in cancer patients, and molecular mechanisms underlying AAD resistance remain largely unknown. Here we describe AAD-triggered, lipid-dependent metabolic reprogramming as an alternative mechanism of AAD resistance. Unexpectedly, tumor angiogenesis in adipose
Jin Seok et al.
Stem cell research & therapy, 11(1), 1-1 (2020-01-05)
Human placenta-derived mesenchymal stem cells (PD-MSCs) are powerful sources for cell therapy in regenerative medicine. However, a limited lifespan by senescence through mechanisms that are well unknown is the greatest obstacle. In the present study, we first demonstrated the characterization