Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAATTCGCTGGGGATAAAGGCTACTTAACAAAGGAGGACCTGAGAGTACTCATGGAAAAGGAGTTCCCTGGATTTTTGGAAAATCAAAAAGACCCTCTGGCTGTGGACAAAATAATGAAGGACCTGGACCAGTGTAGAGATGGCAAAGTGGGCTTCCAGAGCTTCTTTTCCCTAATTGCGGGCCTCACCATTGCATGCAATGACTATTTTGTAGTACACATGAAGCAGAAGGGAAAGAAGTAGGCAGAAATGAGCAGTTCGCTCCTCCCTGATAAGAGTTGTCCCAAAGGGTCGCTTAAGGAATCTGCCCCACAGCTTCCCCCATAGAAGGATTTCATGAGCAGATCAGGACACTTAGCAAATGTAAAAATAAAATCTAACTCTCATTTGACAAGCAGAGAAAGAAAAGTTAAATACCAGATAAGCTTTTGATTTTTGTATTGTTTGCATCCCCTTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... S100A10(6281)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan Li et al.
Frontiers in cell and developmental biology, 8, 559486-559486 (2020-12-17)
S100 calcium-binding protein A10 (S100A10) is crucially involved in the tumorigenesis of multiple malignant tumors. Reprogrammed glucose metabolism is emerging as a hallmark of various human cancers. However, the function of S100A10 in aerobic glycolysis is unclear. The expression of
Moamen Bydoun et al.
Scientific reports, 8(1), 14091-14091 (2018-09-22)
Cancer dissemination is initiated by the movement of cells into the vasculature which has been reported to be triggered by EMT (epithelial to mesenchymal transition). Cellular dissemination also requires proteases that remodel the extracellular matrix. The protease, plasmin is a
K-W Lee et al.
Molecular psychiatry, 20(12), 1546-1556 (2015-09-16)
Mood disorders and antidepressant therapy involve alterations of monoaminergic and glutamatergic transmission. The protein S100A10 (p11) was identified as a regulator of serotonin receptors, and it has been implicated in the etiology of depression and in mediating the antidepressant actions