Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTGGACACCGAGGAACAGTAAGAGATTATCCAGACTTTAGCCCATCAGTGGATGCTGAAGCTATTCAGAAAGCAATCAGAGGAATTGGAACTGATGAGAAAATGCTCATCAGCATTCTGACTGAGAGGTCAAATGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCATATGGAAAGGAGCTGAAAGATGACTTGAAGGGTGATCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTAGTGACTCCACCAGCAGTCTTTGATGCAAAGCAGCTAAAGAAATCCATGAAGGGCGCGGGAACAAACGAAGATGCCTTGATTGAAATCTTAACTACCAGGACAAGCAGGCAAATGAAGGATATCTCTCAAGCCTATTATACAGTATACAAGAAGAGTCTTGGAGATGACATTAGTTCCGAAACATCTGGTGACTTCCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ANXA3(306)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ruisi Xu et al.
Journal of cellular biochemistry, 120(9), 14585-14593 (2019-04-19)
Colorectal cancer (CRC) is a common disease with high mortality and morbidity. Annexin A3 (ANXA3) belongs to the structurally homologous family of Ca2+ and phospholipid-binding proteins. This study aimed to investigate the effects and potential mechanisms of ANXA3 on oxaliplatin
S Y Yu et al.
Neoplasma, 61(3), 257-264 (2014-05-16)
Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric
Qiu-Zhong Pan et al.
Molecular carcinogenesis, 54(8), 598-607 (2014-01-01)
Annexin A3 (ANXA3) has been found to play important roles in cancer progression, metastasis, and drug resistance; however, its role in hepatocellular carcinoma (HCC) remains unknown. In this study, we investigated the expression level, clinical significance and biologic function of