Skip to Content
Merck

EHU061701

MISSION® esiRNA

targeting human TNFSF11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TNFSF11(8600)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Aase Haj Hensvold et al.
Arthritis research & therapy, 17, 239-239 (2015-09-05)
Receptor activator of nuclear factor kappa B ligand (RANKL) is a key regulator of bone metabolism. Anti-citrullinated protein antibodies (ACPA) have been suggested to cause bone destruction by osteoclast activation. We investigated the relationship between RANKL and ACPA in patients
Hae-Rim Kim et al.
PloS one, 10(4), e0124909-e0124909 (2015-04-22)
Vascular endothelial growth factor (VEGF) has angiogenic, inflammatory, and bone-destructive roles in rheumatoid arthritis (RA). We aimed to determine the unique role of VEGF in osteoclastogenesis in RA. VEGF-induced receptor activator of nuclear factor ҡB ligand (RANKL) expression was determined
Hong Hu et al.
Breast cancer research and treatment, 146(3), 515-523 (2014-07-11)
The receptor activator of nuclear factor-κB ligand (RANKL) acts as a paracrine factor in progesterone-induced mammary epithelial proliferation and tumorigenesis. This evidence comes mainly from mouse models. Our aim was to examine whether RANKL expression in human normal and malignant