Skip to Content
Merck

EHU064181

MISSION® esiRNA

targeting human PKLR

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGAACCTCCAGAAGCCATCTGGGCAGATGATGTAGATCGCCGGGTGCAATTTGGCATTGAAAGTGGAAAGCTCCGTGGCTTCCTCCGTGTTGGAGACCTGGTGATTGTGGTGACAGGCTGGCGACCTGGCTCCGGCTACACCAACATCATGCGGGTGCTAAGCATATCCTGAGACGCCCCTCCCTCCTCTGGCCCAGCCTACCCTTGTACCCCATCCCTTCCTCCCCAGTCTACGTTCTCCAGCCCACACCCCTCCAAAGCCCCACCTTTAAGTCCTCTCTTCTCTATTCCTGACCCTCCCTACCTGAGGCCTATCTGAGACTATAACTGTCATCTAGCCCCTTCGAGGTTGCCCCTTCCCCATCTCCATTTCACACAGGTCCTGAAAGTCTGTGTCCAATTATGCACTGGCCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PKLR(5313)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xiaoqiong Duan et al.
Journal of virology, 92(7) (2018-01-13)
Hepatitis C virus (HCV) infection has been shown to regulate microRNA 130a (miR-130a) in patient biopsy specimens and in cultured cells. We sought to identify miR-130a target genes and to explore the mechanisms by which miR-130a regulates HCV and hepatitis
Stephanie Dabo et al.
Scientific reports, 7(1), 16129-16129 (2017-11-25)
PKR is a cellular kinase involved in the regulation of the integrative stress response (ISR) and pro-inflammatory pathways. Two N-terminal dsRNA Binding Domains (DRBD) are required for activation of PKR, by interaction with either dsRNA or PACT, another cellular DRBD-containing
D C Tanner et al.
Cell death and differentiation, 22(9), 1489-1501 (2015-01-31)
Neuroinflammation associated with degenerative central nervous system disease and injury frequently results in oligodendrocyte death. While promoting oligodendrocyte viability is a major therapeutic goal, little is known about protective signaling strategies. We report that in highly purified rat oligodendrocytes, interferon