Skip to Content
Merck

EHU074371

MISSION® esiRNA

targeting human DRD2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGGAGATGGAGATGCTCTCCAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTCCCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGCATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCGGACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATGCTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACATACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAGCGCCGTGAACCCCATCATCTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DRD2(1813)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Carole Deyts et al.
PloS one, 4(12), e8287-e8287 (2009-12-18)
Huntington's disease (HD) is a polyglutamine-expanded related neurodegenerative disease. Despite the ubiquitous expression of expanded, polyQ-Huntingtin (ExpHtt) in the brain, striatal neurons present a higher susceptibility to the mutation. A commonly admitted hypothesis is that Dopaminergic inputs participate to this
Yanrong Zhang et al.
PloS one, 7(6), e38745-e38745 (2012-06-22)
Renal dopamine receptors participate in the regulation of blood pressure. Genetic factors, including polymorphisms of the dopamine D(2) receptor gene (DRD2) are associated with essential hypertension, but the mechanisms of their contribution are incompletely understood. Mice lacking Drd2 (D(2)-/-) have
Hongli Huang et al.
International immunopharmacology, 39, 113-120 (2016-07-29)
Dopamine (DA), an important neurotransmitter, has been reported to play a negative role in tumor progression. DA acts its role via dopamine receptors (DRs), which can be divided into five receptor subtypes (D1R-D5R). Among these receptor subtypes, D2R has been