Skip to Content
Merck

EHU078751

MISSION® esiRNA

targeting human ERBB2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAATGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ERBB2(2064)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Tiia Honkanen et al.
International journal of oncology, 51(2), 599-606 (2017-06-29)
We have previously shown that cancer stem-like cells (CSLCs) can mediate therapy resistance in ALK translocated lung cancers. HER2 has been linked to CSLCs in breast cancers and, therefore, we wanted to assess whether HER2 has a role in CSLCs
Nehal Gupta et al.
Scientific reports, 9(1), 5066-5066 (2019-03-27)
Paclitaxel is a first line chemotherapeutic agent for the patients with metastatic breast cancer. But inherited or acquired resistance to paclitaxel leads to poor response rates in a majority of these patients. To identify mechanisms of paclitaxel resistance, we developed
T-T Yu et al.
European review for medical and pharmacological sciences, 24(10), 5267-5280 (2020-06-05)
To explore possible mechanism of ERBB2 gene expression silencing mediating mitogen-activated protein kinase 1/mitogen-activated protein kinase 3 (MAPK1/MAPK3) signaling pathway on proliferation, migration, and invasion of ovarian cancer cells. A total of 240 cancer specimens were collected in patients with