Skip to Content
Merck

EHU081301

MISSION® esiRNA

targeting human RACGAP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTCATTGTTGGGAGCTTTTAGATGAGACATCTTTCCAGGGGTAGAAGGGTTAGTATGGAATTGGTTGTGATTCTTTTTGGGGAAGGGGGTTATTGTTCCTTTGGCTTAAAGCCAAATGCTGCTCATAGAATGATCTTTCTCTAGTTTCATTTAGAACTGATTTCCGTGAGACAATGACAGAAACCCTACCTATCTGATAAGATTAGCTTGTCTCAGGGTGGGAAGTGGGAGGGCAGGGCAAAGAAAGGATTAGACCAGAGGATTTAGGATGCCTCCTTCTAAGAACCAGAAGTTCTCATTCCCCATTATGAACTGAGCTATAATATGGAGCTTTCATAAAAATGGGATGCATTGAGGACAGAACTAGTGATGGGAGTATGCGTAGCTTTGATTTGGATGATTAGGTCTTTAATAGTGTTGAGTGGCACAACCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RACGAP1(29127)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xinchun Ding et al.
Oncotarget, 8(18), 30123-30137 (2017-04-19)
Lysosomal acid lipase (LAL) is a critical neutral lipid metabolic enzyme that regulates metabolic reprogramming in myeloid-derived suppressor cells (MDSCs) through over-activation of mammalian target of rapamycin (mTOR). Affymetrix GeneChip microarray analysis of MDSCs from LAL deficient mouse (lal-/-) revealed
Toshiyuki Kawashima et al.
The Journal of cell biology, 175(6), 937-946 (2006-12-21)
STAT transcription factors are tyrosine phosphorylated upon cytokine stimulation and enter the nucleus to activate target genes. We show that Rac1 and a GTPase-activating protein, MgcRacGAP, bind directly to p-STAT5A and are required to promote its nuclear translocation. Using permeabilized
Matthew L Kutys et al.
Nature cell biology, 16(9), 909-917 (2014-08-26)
Rho-family GTPases govern distinct types of cell migration on different extracellular matrix proteins in tissue culture or three-dimensional (3D) matrices. We searched for mechanisms selectively regulating 3D cell migration in different matrix environments and discovered a form of Cdc42-RhoA crosstalk