Skip to Content
Merck

EHU088861

MISSION® esiRNA

targeting human ITGA6

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTCTTCATTTGGCTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGGCAAGATATAGTTATTGGAGCCCCACAGTATTTTGATAGAGATGGAGAAGTTGGAGGTGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATAATGTGAAGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGCATTGCAGTAAAAAATATTGGAGATATTAATCAAGATGGCTACCCAGATATTGCAGTTGGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ITGA6(3655)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Chunbo He et al.
Cell reports, 26(10), 2636-2650 (2019-03-07)
HPV infections are common in healthy women and only rarely cause cervical cancer, suggesting that individual genetic susceptibility may play a critical role in the establishment of persistent HPV infection and the development of cervical cancer. Here, we provide convincing in vitro
Daiane Cristina F Golbert et al.
Cell adhesion & migration, 12(2), 152-167 (2017-05-12)
The thymus supports differentiation of T cell precursors. This process requires relocation of developing thymocytes throughout multiple microenvironments of the organ, mainly with thymic epithelial cells (TEC), which control intrathymic T cell differentiation influencing the formation and maintenance of the
Miyeon Kim et al.
Stem cells international, 2020, 5924983-5924983 (2020-05-14)
Mesenchymal stem cells (MSCs) represent a promising means to promote tissue regeneration. However, the heterogeneity of MSCs impedes their use for regenerative medicine. Further investigation of this phenotype is required to develop cell therapies with improved clinical efficacy. Here, a