Skip to Content
Merck

EHU092941

MISSION® esiRNA

targeting human ARHGEF2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAATCCCTCATTGACGAAGAGGTAATCTACAGTGAGCTGATGAGTGACTTTGAGATGGATGAGAAGGACTTTGCAGCTGACTCTTGGAGTCTTGCTGTGGACAGCAGCTTCCTGCAGCAGCATAAAAAGGAGGTGATGAAGCAGCAAGATGTCATCTATGAGCTAATCCAGACAGAGCTGCACCATGTGAGGACACTGAAGATCATGACCCGCCTCTTCCGCACGGGGATGCTGGAAGAGCTACACTTGGAGCCAGGAGTGGTCCAGGGCCTGTTCCCCTGCGTGGACGAGCTCAGTGACATCCATACACGCTTCCTCAGCCAGCTATTAGAACGCCGACGCCAGGCCCTGTGCCCTGGCAGCACCCGGAACTTTGTCATCCATCGCTTGGGTGATCTGCTCATCAGCCAGTTCTCAGGTCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ARHGEF2(9181)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Michelle Rengarajan et al.
Molecular biology of the cell, 31(19), 2097-2106 (2020-06-26)
Interactions between host cells and individual pathogenic bacteria determine the clinical severity of disease during systemic infection in humans. Vascular endothelial cells, which line the lumen of blood vessels, represent a critical barrier for a bacterium in the bloodstream. These
Meng Pan et al.
Science advances, 6(31), eaaz1534-eaaz1534 (2020-08-14)
Microtubules display dynamic turnover during cell migration, leading to cell contractility and focal adhesion maturation regulated by Rho guanosine triphosphatase activity. This interplay between microtubules and actomyosin is mediated by guanine nucleotide exchange factor (GEF)-H1 released after microtubule depolymerization or
Tony Y-C Tsai et al.
Developmental cell, 49(2), 189-205 (2019-04-25)
Efficient chemotaxis requires rapid coordination between different parts of the cell in response to changing directional cues. Here, we investigate the mechanism of front-rear coordination in chemotactic neutrophils. We find that changes in the protrusion rate at the cell front