Skip to Content
Merck

EHU093851

MISSION® esiRNA

targeting human LPAR2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGACTTGTGGGTGCTCCTGGCTCAACCCAACCAACAGGACTGACTGACTGGCAGGACAAGGTCTGGCATGGCACAGCACCACTGCCAGGCCTCCCCAGGCACACCACTCTGCCCAGGGAATGGGGGCTTTGGGTCATCTCCCACTGCCTGGGGGAGTCAGATGGGGTGCAGGAATCTGGCTCTTCAGCCATCTCAGGTTTAGGGGGTTTGTAACAGACATTATTCTGTTTTCACTGCGTATCCTTGGTAAGCCCTGTGGACTGGTTCCTGCTGTGTGATGCTGAGGGTTTTAAGGTGGGGAGAGATAAGGGCTCTCTCGGGCCATGCTACCCGGTATGACTGGGTAATGAGGACAGACTGTGGACACCCCATCTACCTGAGTCTGATTCTTTAGCAGCAGAGACTGAGGGGTGCAGAGTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LPAR2(9170)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ying Zhang et al.
OncoTargets and therapy, 13, 4145-4155 (2020-06-12)
The dysregulation of the human papillomavirus 18 E6 and E7 oncogenes plays a critical role in the angiogenesis of cervical cancer (CC), including the proliferation, migration, and tube formation of vascular endothelial cells. Interfering E6/E7 increases the number of CC
Zi Wang et al.
Journal of molecular medicine (Berlin, Germany), 98(12), 1781-1794 (2020-11-01)
Autotaxin (ATX) is a secreted enzyme that hydrolyzes lysophosphatidylcholine (LPC) to lysophosphatidic acid (LPA) and choline. ATX has been implicated in multiple chronic inflammatory diseases, but little is known about its role in the development of inflammatory bowel disease (IBD).
Simon McArthur et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 1139-1151 (2015-06-24)
Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer's disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in