Skip to Content
Merck

EHU101361

MISSION® esiRNA

targeting human MAP3K3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTGCAGCATGAGCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCTGACCATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTTACGGTGCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGGGCATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAP3K3(4215)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yue Zheng et al.
FEBS letters, 591(15), 2290-2298 (2017-06-24)
Lineage-negative bone marrow cells (lin-BMCs) have reparative potential for overcoming endothelial dysfunction and reducing cardiovascular risk. Here, we found that miR-188 is upregulated and mitogen-activated protein kinase kinase kinase 3 (MAP3K3) is downregulated in aged lin-BMCs, whereas their expression is reversed
Longping Yao et al.
Journal of neuroinflammation, 15(1), 13-13 (2018-01-14)
Parkinson's disease (PD) is the most prevalent neurodegenerative disorder that is characterised by selective loss of midbrain dopaminergic (DA) neurons. Chronic inflammation of the central nervous system is mediated by microglial cells and plays a critical role in the pathological
Ganesh Umapathy et al.
Science signaling, 7(349), ra102-ra102 (2014-10-30)
Anaplastic lymphoma kinase (ALK) is an important molecular target in neuroblastoma. Although tyrosine kinase inhibitors abrogating ALK activity are currently in clinical use for the treatment of ALK-positive (ALK(+)) disease, monotherapy with ALK tyrosine kinase inhibitors may not be an