Skip to Content
Merck

EHU107461

MISSION® esiRNA

targeting human RPS6KB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RPS6KB1(6198)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Subin Jin et al.
Journal of Korean medical science, 32(8), 1327-1336 (2017-07-01)
Microarray analysis was used to investigate the lack of identified mammalian target of rapamycin (mTOR) pathway downstream genes to overcome cross-talk at non-muscle invasive high-grade (HG)-urothelial carcinoma (UC) of the bladder, gene expression patterns, gene ontology, and gene clustering by
Tao Zhang et al.
International journal of molecular sciences, 15(2), 3154-3171 (2014-02-26)
The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), either alone or in combination with other anti-cancer agents, has been considered as a new strategy for anti-cancer therapy. In this study, we demonstrated that evodiamine, a quinolone alkaloid isolated from the fruit
Suleman S Hussain et al.
Cancer letters, 433, 232-241 (2018-07-14)
Radiation therapy (XRT) is a standard treatment for prostate cancer (PCa). Although dose escalation increases local control, toxicity hampers further escalation. Broader improvement will be possible by the addition of adjuvant therapies, which can synergize with radiation and thus improve