Skip to Content
Merck

EHU111121

MISSION® esiRNA

targeting human SLC2A3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCCAGGATGTATCCCAAGACATCCAGGAGATGAAAGATGAGAGTGCAAGGATGTCACAAGAAAAGCAAGTCACCGTGCTAGAGCTCTTTAGAGTGTCCAGCTACCGACAGCCCATCATCATTTCCATTGTGCTCCAGCTCTCTCAGCAGCTCTCTGGGATCAATGCTGTGTTCTATTACTCAACAGGAATCTTCAAGGATGCAGGTGTTCAAGAGCCCATCTATGCCACCATCGGCGCGGGTGTGGTTAATACTATCTTCACTGTAGTTTCTCTATTTCTGGTGGAAAGGGCAGGAAGAAGGACTCTGCATATGATAGGCCTTGGAGGGATGGCTTTTTGTTCCACGCTCATGACTGTTTCTTTGTTATTAAAGGATAACTATAATGGGATGAGCTTTGTCTGTATTGGGGCTATCTTGGTCTTTGTAGCCTTCTTTGAAATTGGACCAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Linhua Jiang et al.
Oncology letters, 21(4), 312-312 (2021-03-12)
Yes-associated protein (YAP), as a major downstream effector in the Hippo signaling pathway, is considered as an oncogene in cancer. The present study aimed to investigate the potential role of YAP in the development and progression of colorectal cancer (CRC).
Ko-Jen Li et al.
Clinical & developmental immunology, 2012, 548516-548516 (2011-10-19)
Urinary excretion of N-benzoyl-glycyl-Nε-(hexanonyl)lysine, a biomarker of oxidative stress, was higher in 26 patients with active systemic lupus erythematosus (SLE) than in 11 non-SLE patients with connective tissue diseases and in 14 healthy volunteers. We hypothesized that increased oxidative stress
Érika Cosset et al.
Cancer cell, 32(6), 856-868 (2017-12-05)
While molecular subtypes of glioblastoma (GBM) are defined using gene expression and mutation profiles, we identify a unique subpopulation based on addiction to the high-affinity glucose transporter, Glut3. Although Glut3 is a known driver of a cancer stem cell phenotype