Skip to Content
Merck

EHU113451

MISSION® esiRNA

targeting human RAB6A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAATCTCCCATGTCATCTTCAACCTTCTTCAGAAGCTCACTGCTTTGGCCCCCTTACTCTTTCATTGACTGCAGTGTGAATATTGGCTTGAACCTTTTCCCTTCAGTAATAACGTATTGCAATTCATCATTGCTGCCTGTCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAB6A(5870)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Fang Wang et al.
Journal of cellular biochemistry (2018-11-13)
Previous studies have demonstrated that hypoxia can induce phenotypic modulation of pulmonary smooth muscle cells; however, the mechanisms remain unclear. The present study aimed to investigate the effect of the GTPase Rab6A-mediated phenotypic modulation and other activities of rat pulmonary
Anand Patwardhan et al.
Nature communications, 8, 15835-15835 (2017-06-14)
Exocytic carriers convey neo-synthesized components from the Golgi apparatus to the cell surface. While the release and anterograde movement of Golgi-derived vesicles require the small GTPase RAB6, its effector ELKS promotes the targeting and docking of secretory vesicles to particular
Haili Huang et al.
Cancer letters, 362(1), 15-24 (2015-03-11)
Our previous study demonstrated that microRNA 5100 (miR-5100) is overexpressed in lung cancer tissues; however, the function of miR-5100 remained elusive. In this study, we demonstrate that miR-5100 is highly expressed in a wide variety of lung cancer tissues and