Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAATCTCCCATGTCATCTTCAACCTTCTTCAGAAGCTCACTGCTTTGGCCCCCTTACTCTTTCATTGACTGCAGTGTGAATATTGGCTTGAACCTTTTCCCTTCAGTAATAACGTATTGCAATTCATCATTGCTGCCTGTCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAB6A(5870)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Fang Wang et al.
Journal of cellular biochemistry (2018-11-13)
Previous studies have demonstrated that hypoxia can induce phenotypic modulation of pulmonary smooth muscle cells; however, the mechanisms remain unclear. The present study aimed to investigate the effect of the GTPase Rab6A-mediated phenotypic modulation and other activities of rat pulmonary
Anand Patwardhan et al.
Nature communications, 8, 15835-15835 (2017-06-14)
Exocytic carriers convey neo-synthesized components from the Golgi apparatus to the cell surface. While the release and anterograde movement of Golgi-derived vesicles require the small GTPase RAB6, its effector ELKS promotes the targeting and docking of secretory vesicles to particular
Haili Huang et al.
Cancer letters, 362(1), 15-24 (2015-03-11)
Our previous study demonstrated that microRNA 5100 (miR-5100) is overexpressed in lung cancer tissues; however, the function of miR-5100 remained elusive. In this study, we demonstrate that miR-5100 is highly expressed in a wide variety of lung cancer tissues and