Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGATCCAGGCCATGAAGAAGCTGCGGCACAAACACATCCTGGCGCTGTACGCCGTGGTGTCCGTGGGGGACCCCGTGTACATCATCACGGAGCTCATGGCCAAGGGCAGCCTGCTGGAGCTGCTCCGCGACTCTGATGAGAAAGTCCTGCCCGTTTCGGAGCTGCTGGACATCGCCTGGCAGGTGGCTGAGGGCATGTGTTACCTGGAGTCGCAGAATTACATCCACCGGGACCTGGCCGCCAGGAACATCCTCGTCGGGGAAAACACCCTCTGCAAAGTTGGGGACTTCGGGTTAGCCAGGCTTATCAAGGAGGACGTCTACCTCTCCCATGACCACAATATCCCCTACAAGTGGACGGCCCCTGAAGCGCTCTCCCGAGGCCATTACTCCACCAAATCCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTK6(5753)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiaohong Chen et al.
American journal of translational research, 8(10), 4354-4361 (2016-11-11)
Protein tyrosine kinase 6 (PTK6) is a nonreceptor tyrosine kinase that plays a crucial role in some tumors. However, the role of PTK6 is still unknown in hepatocellular carcinoma (HCC). In this study, we demonstrated that the PTK6 expression was
Tao Li et al.
Cancer management and research, 12, 6477-6491 (2020-08-18)
Serum response factor (SRF), a sequence-specific transcription factor, is closely related to metastasis of gastric cancer, a digestive tract cancer. Herein, we probed the effect of SRF on metastasis and progression of colon cancer (CC), another digestive tract disorder, and
Sayem Miah et al.
BMC cancer, 19(1), 78-78 (2019-01-18)
BRK is, a non-receptor tyrosine kinase, overexpressed in approximately 85% of human invasive ductal breast tumors. It is not clear whether BRK expression correlates with breast cancer subtypes, or the expression has prognostic or diagnostic significance. Herein, we investigated the