Skip to Content
Merck

EHU131401

MISSION® esiRNA

targeting human IGFBP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGAAACCAGATGAAATAATGTTCTGTCACGTGAAATATTTAAGTATATAGTATATTTATACTCTAGAACATGCACATTTATATATATATGTATATGTATATATATATAGTAACTACTTTTTATACTCCATACATAACTTGATATAGAAAGCTGTTTATTTATTCACTGTAAGTTTATTTTTTCTACACAGTAAAAACTTGTACTATGTTAATAACTTGTCCTATGTCAATTTGTATATCATGAAACACTTCTCATCATATTGTATGTAAGTAATTGCATTTCTGCTCTTCCAAAGCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGFBP1(3484)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Fang Zheng et al.
Experimental & molecular medicine, 50(9), 121-121 (2018-09-14)
β-Elemene, an active component of natural plants, has been shown to exhibit anticancer properties. However, the detailed mechanism underlying these effects has yet to be determined. In this study, we show that β-elemene inhibits the growth of lung cancer cells.
Hideno Tochigi et al.
Scientific reports, 7, 40001-40001 (2017-01-05)
Endometrial decidualization represents an essential step for the successful implantation of the embryo; however, the molecular mechanism behind this differentiation process remains unclear. This study aimed to identify novel microRNAs (miRNAs) involved in the regulation of decidual gene expression in
Ali Vaziri-Gohar et al.
Molecular and cellular endocrinology, 422, 160-171 (2015-12-23)
Tamoxifen, a selective estrogen receptor modulator, is a commonly prescribed adjuvant therapy for estrogen receptor-α (ERα)-positive breast cancer patients. To determine if extracellular factors contribute to the modulation of IGF-1 signaling after tamoxifen treatment, MCF-7 cells were treated with IGF-1 in