Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAATCTTTCAGCCTGCTTCTTCCCCAGGGTTCTGTATTGCAGCTAAGCTCAAATGTATATTTAACTTCTAGTTGCTCTTGCTTTGGTCTTCTTCCAATGATGCTTACTACAGAAAGCAAATCAGACACAATTAGAGAAGCCTTTTCCATAAAGTGTAATTTTAATGGCTGCAAAACCGGCAACCTGTAACTGCCCTTTTAAATGGCATGACAAGGTGTGCAGTGGCCCCATCCAGCATGTGTGTGTCTCTATCTTGCATCTACCTGCTCCTTGGCCTAGTCAGATGGATGTAGATACAGATCCGCATGTGTCTGTATTCATACAGCACTACTTACTTAGAGATGCTACTGTCAGTGTCCTCAGGGCTCTACCAAGACATAATGCACTGGGGTACCACATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MAPK10(5602)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yang Wang et al.
Journal of medical genetics, 57(9), 634-642 (2020-02-19)
Hirschsprung disease (HSCR) is a life-threatening congenital disorder in which the enteric nervous system is completely missing from the distal gut. Recent studies have shown that miR-4516 markedly inhibits cell migration, and as one of its potential targets, MAPK10 functions
Baohua Qiao et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 380-388 (2020-02-13)
Ovarian cancer (OC) represents the most lethal form of gynaecologic cancers in developed countries. To develop a better therapeutic against OC, characterizing new classes of molecular regulators such as microRNAs (miRNAs) involved in OC tumorigenesis becomes immensely important. We used
Sarah Huntwork-Rodriguez et al.
The Journal of cell biology, 202(5), 747-763 (2013-08-28)
Neurons are highly polarized cells that often project axons a considerable distance. To respond to axonal damage, neurons must transmit a retrograde signal to the nucleus to enable a transcriptional stress response. Here we describe a mechanism by which this