Skip to Content
Merck

EHU149811

MISSION® esiRNA

targeting human IGFBP5

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGTGGGCTTTTTCCCTTTTTTGCTCCTTTTCATTACCCCTCCTCCGTTTTCACCCTTCTCCGGACTTCGCGTAGAACCTGCGAATTTCGAAGAGGAGGTGGCAAAGTGGGAGAAAAGAGGTGTTAGGGTTTGGGGTTTTTTTGTTTTTGTTTTTGTTTTTTAATTTCTTGATTTCAACATTTTCTCCCACCCTCTCGGCTGCAGCCAACGCCTCTTACCTGTTCTGCGGCGCCGCGCACCGCTGGCAGCTGAGGGTTAGAAAGCGGGGTGTATTTTAGATTTTAAGCAAAAATTTTAAAGATAAATCCATTTTTCTCTCCCACCCCCAACGCCATCTCCACTGCATCCGATCTCATTATTTCGGTGGTTGCTTGGGGGTGAACAATTTTGTGGCTTTTTTTCCCCTATAATTCTGACCCGCTCAGGCTTGAGGGTTTCTCCGGCCTCCGCTCACTGCGTGCACCTGGCGCTGCCCTGCTTCCCCCAACCTGTTGCAAGGCTTTAATTCTTGCAACTGGGACCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGFBP5(3488)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Dong Hyup Lee et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 17(2), 157-162 (2013-04-30)
Insulin-like growth factor binding proteins (IGFBPs) are important components of insulin growth factor (IGF) signaling pathways. One of the binding proteins, IGFBP-5, enhances the actions of IGF-1, which include the enhanced proliferation of smooth muscle cells. In the present study
Younghay Lee et al.
Cells, 8(4) (2019-04-26)
Type 2 diabetes mellitus (T2DM) is a prevalent chronic metabolic disorder accompanied by high blood glucose, insulin resistance, and relative insulin deficiency. Endoplasmic reticulum (ER) stress induced by high glucose and free fatty acids has been suggested as one of
Bong-Ki Hong et al.
Experimental & molecular medicine, 49(8), e363-e363 (2017-08-05)
Fibroblast-like synoviocytes (FLSs) constitute a major cell subset of rheumatoid arthritis (RA) synovia. Dysregulation of microRNAs (miRNAs) has been implicated in activation and proliferation of RA-FLSs. However, the functional association of various miRNAs with their targets that are characteristic of