Skip to Content
Merck

EHU153841

MISSION® esiRNA

targeting human NFKB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGACAAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCCAGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NFKB1(4790)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jie Song et al.
Molecular carcinogenesis, 56(1), 36-48 (2016-02-10)
Inflammatory microenvironment created by immune cells is favorable for tumor metastasis. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in inflammatory microenvironment. In this study, we sought to investigate the effects of Icariside II, a
Jing Zhou et al.
BioMed research international, 2018, 1650456-1650456 (2018-11-08)
Intermittent hypoxia (IH) that resulted from obstructive sleep apnea (OSA) has been found to be a risk factor of coronary artery disease. IH and the receptor for advanced glycation end products (RAGE) expression are known to activate monocyte/macrophage and associated
Yunxia Guo et al.
Cytotechnology, 73(1), 115-126 (2021-01-29)
This study intended to investigate the role of NFKB1 in oxidative stress injury and insulin resistance in gestational hypertension (GH) mice. Following establishment of a GH mouse model by high-fat diet, NFKB1, miR-106a, and FLOT2 expression was detected in liver