Skip to Content
Merck

EHU158801

MISSION® esiRNA

targeting human MYLK (1)

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAGAATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTGCTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTGTCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATCTGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAACGTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTATGGAACCAGTGAGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYLK(4638)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Sho Hiroyasu et al.
Journal of cell science, 130(14), 2329-2343 (2017-06-10)
During healing of the skin, the cytoskeleton of keratinocytes and their matrix adhesions, including focal adhesions (FAs), undergo reorganization. These changes are coordinated by small GTPases and their regulators, including the guanine nucleotide exchange factor β-PIX (also known as ARHGEF7).
Shaoqing Chen et al.
Journal of cellular physiology, 235(11), 7757-7768 (2019-11-20)
Long noncoding RNAs (lncRNAs) play a crucial role in several malignances, involving nasopharyngeal carcinoma (NPC), a heterogeneous disease. This study investigated mechanism of serine/arginine repetitive matrix protein 2-alternative splicing (SRRM2-AS) in NPC cell proliferation, differentiation, and angiogenesis. Initially, differentially expressed
Nityanand Srivastava et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12805-12819 (2020-08-11)
Increased endothelial permeability leads to excessive exudation of plasma proteins and leukocytes in the interstitium, which characterizes several vascular diseases including acute lung injury. The myosin light chain kinase long (MYLK-L) isoform is canonically known to regulate the endothelial permeability