Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGGCACCTCTACTACCACAGTCTTCAACTTCCCTGTTTCCATCCCCGTCCACCCCACGAACAGTGCCCTGAACTACCTTAAAAGCCCCATCACCACCTCTCCAAGCTGCTGAAGGGCAAGGGGAGGTGTGGAGTTTCACTTGCCACCGGGTCGCCACTCCTCCTGTGGGAGGAGCAATGCAATAACTCTGGGAGAGGCTCATGGGAGCTGGTCCTTATTTATTTAACACCCCCCTCACCCCCCAACTCCTCCTGAGTTCCACTGAGTTCCTAAGCAGTCACAACAATGACTTGACCGCAAGACATTTGCTGAACTCGGCACATTCGGGACCAATATATTGTGGGTACATCAAGTCCCTCTGACAAAACAGGGCAGAAGAGAAAGGACTCTGTTTGAGGCAGTTTCTTCGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... DUSP1(19252), Dusp1(19252)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chaoyong He et al.
Diabetes, 64(12), 4285-4297 (2015-04-11)
Activation of AMPK suppresses inflammation, but the underlying mechanisms remain poorly understood. This study was designed to characterize the molecular mechanisms by which AMPK suppresses vascular inflammation. In cultured human aortic smooth muscle cells, pharmacologic or genetic activation of AMPK
Maria M Talavera et al.
Pediatric research, 78(2), 128-136 (2015-05-08)
Necrotizing enterocolitis is characterized by intestinal inflammation and epithelial barrier dysfunction. Mitogen-activated protein kinase (MAPK) phosphatase (MKP)-1 plays a pivotal role in the feedback control of MAPK signaling, which regulates inflammation and apoptosis. We hypothesized that MKP-1 prevents lipopolysaccharide (LPS)-induced
Brijeshkumar S Patel et al.
Cancer biology & therapy, 16(5), 780-789 (2015-03-17)
Mitogen activated protein kinase phosphatase-1 (MKP-1) has emerged as an important protein mediating breast cancer oncogenesis and chemoresistance to cancer chemotherapies, especially proteasome inhibitors. In this in vitro study, we utilized the breast cancer epithelial cell lines MCF-7 and MDA-MB-231