Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAGGAAGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGAGTTGCATCTCATTTTCTTCTGTAAAAACAATTACAGTAGCACATTAATTTAAATCTGTGTTTTTAACTACCGTGGGAGGAACTATCCCACCAAAGTGAGAACGTTATGTCATGGCCATACAAGTAGTCTGTCAACCTCAGACACTGGTTTCGAGACAGTTTACACTTGACAGTTGTTCATTAGCGCACAGTGCCAGAACGCACACTGAGGTGAGTCTCCTGGAACAGTGGAGATGCCAGGAGAAAGAAAGACAGGTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACCGGGGAGGGAAATTATAGCATGCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCTCCACTAGATGAGGCTGAGTCCAGCTGT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CTGF(14219), Ctgf(14219)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
James Hutchenreuther et al.
The Journal of investigative dermatology, 135(11), 2805-2813 (2015-07-15)
Metastatic melanoma has an extremely poor prognosis with few durable remissions. The secreted matricellular protein connective tissue growth factor (CCN2) is overexpressed in cancers including melanoma and may represent a viable therapeutic target. However, the mechanism underlying the contribution of
Tian Tian et al.
American journal of cancer research, 5(5), 1823-1830 (2015-07-16)
Glioblastoma multiforme (GBM) is the deadliest and most common form of malignant primary brain tumor in humans. However, until now, little is known about the glioma genesis and progression at the molecular level. Here we report that overexpression of sine
Yunzhuo Ren et al.
Drug design, development and therapy, 9, 4155-4171 (2015-08-11)
Transforming growth factor-β1 (TGF-β1) plays an important role in the pathogenesis and progression of chronic kidney disease. Connective tissue growth factor (CTGF) is a critical fibrogenic mediator of TGF-β1. Mammalian sirtuin 1 (Sirt1) is reported to attenuate renal fibrosis by