Skip to Content
Merck

EMU022801

MISSION® esiRNA

targeting mouse Ctgf

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGGAAGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGAGTTGCATCTCATTTTCTTCTGTAAAAACAATTACAGTAGCACATTAATTTAAATCTGTGTTTTTAACTACCGTGGGAGGAACTATCCCACCAAAGTGAGAACGTTATGTCATGGCCATACAAGTAGTCTGTCAACCTCAGACACTGGTTTCGAGACAGTTTACACTTGACAGTTGTTCATTAGCGCACAGTGCCAGAACGCACACTGAGGTGAGTCTCCTGGAACAGTGGAGATGCCAGGAGAAAGAAAGACAGGTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACCGGGGAGGGAAATTATAGCATGCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCTCCACTAGATGAGGCTGAGTCCAGCTGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



James Hutchenreuther et al.
The Journal of investigative dermatology, 135(11), 2805-2813 (2015-07-15)
Metastatic melanoma has an extremely poor prognosis with few durable remissions. The secreted matricellular protein connective tissue growth factor (CCN2) is overexpressed in cancers including melanoma and may represent a viable therapeutic target. However, the mechanism underlying the contribution of
Tian Tian et al.
American journal of cancer research, 5(5), 1823-1830 (2015-07-16)
Glioblastoma multiforme (GBM) is the deadliest and most common form of malignant primary brain tumor in humans. However, until now, little is known about the glioma genesis and progression at the molecular level. Here we report that overexpression of sine
Yunzhuo Ren et al.
Drug design, development and therapy, 9, 4155-4171 (2015-08-11)
Transforming growth factor-β1 (TGF-β1) plays an important role in the pathogenesis and progression of chronic kidney disease. Connective tissue growth factor (CTGF) is a critical fibrogenic mediator of TGF-β1. Mammalian sirtuin 1 (Sirt1) is reported to attenuate renal fibrosis by