Skip to Content
Merck

EMU028351

MISSION® esiRNA

targeting mouse Aurka

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTGGCAAACGCTCTGTCTTACTGTCATTCAAAGAGAGTGATCCACAGAGACATTAAGCCAGAGAACTTACTGCTTGGCTCAAACGGAGAGTTGAAGATTGCAGACTTCGGGTGGTCGGTGCATGCTCCATCTTCCAGGAGAACCACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAAGGCCGGATGCATGACGAGAAGGTGGACCTCTGGAGCCTGGGCGTTCTCTGCTATGAGTTCCTAGTGGGGATGCCTCCTTTCGAGGCACATACGTACCAGGAGACTTACAGAAGGATATCTCGGGTTGAATTCACTTTCCCTGACTTTGTGACAGAGGGAGCCAGGGACCTCATTTCAAGACTGTTAAAACACAACGCAAGCCAAAGGCTAACACTAGCGGAAGTCCTTGAGCACCCTTGGATCAAAGCTAATTCTTCCAAACCTCCAACTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Saishu Yoshida et al.
eLife, 9 (2020-08-08)
Mammalian Hedgehog (Hh) signaling plays key roles in embryogenesis and uniquely requires primary cilia. Functional analyses of several ciliogenesis-related genes led to the discovery of the developmental diseases known as ciliopathies. Hence, identification of mammalian factors that regulate ciliogenesis can
Jingjing Li et al.
Oncotarget, 6(11), 9327-9340 (2015-04-15)
Mitosis is choreographed by a number of protein kinases including polo-like kinases and Aurora kinases. As these kinases are frequently dysregulated in cancers, small-molecule inhibitors have been developed for targeted anticancer therapies. Given that PLK1 and Aurora kinases possess both
Hua Yang et al.
Oncotarget, 5(10), 2947-2961 (2014-06-17)
Aurora A and JAK2 kinases are involved in cell division and tumor cell survival, respectively. Here we demonstrate that ectopic expression of Aurora A and JAK2 together is more effective than each alone at inducing non-transformed cells to grow in