Skip to Content
Merck

EMU042191

MISSION® esiRNA

targeting mouse Wee1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGACATGGAAGCCAGTGATTATGAGTTTGAAGATGAAACAAGACCTGCCAAAAGAATTACAATTACTGAAAGCAACATGAAGTCACGGTATACAACTGAATTTCATGAGCTGGAGAAAATTGGTTCTGGAGAATTTGGTTCTGTGTTTAAATGTGTGAAGAGGTTAGATGGATGCATTTATGCCATTAAACGATCAAAAAAACCATTGGCTGGCTCTGTTGATGAGCAGAATGCTTTGAGAGAAGTGTATGCTCACGCTGTGCTTGGACAGCACCCCCACGTCGTTCGCTATTTCTCTGCCTGGGCAGAGGATGACCACATGCTTATACAGAACGAATACTGTAATGGTGGGAGTTTAGCTGATGCTATAAGTGAGAACTACAGAGTCATGAGCTACTTGACTGAAGTAGAGCTGAAGGATCTCCTTTTGCAAGTTGGCCGGGGCTTGAGATACATACATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTTATATCTCGAACCTCAATCCCAAATGCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library