Skip to Content
Merck

EMU054161

MISSION® esiRNA

targeting mouse Anxa3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGATGCGAACGAACTGAAGAAATCCATGAAGGGAACTGGCACAGATGAAGATGCCCTGATTGAAATCCTAACAACCAGGTCAAGCAGGCAGATGAAGGAAATCTCGCAGGCCTATTATACAGTGTATAAGAAGAGCCTCGGGGATGACATTAGCTCTGAGACGTCTGGAGACTTCCGGAAAGCTCTGCTGACTCTGGCAGATGGTAGAAGAGATGAAAGCCTCAAAGTGGATGAACATCTGGCCAAAAAGGATGCTCAGATCCTCTATAATGCTGGTGAGAACAAATGGGGCACAGACGAAGACAAATTCACCGAGGTCTTGTGTCTACGGAGCTTCCCGCAGCTGAAACTAACATTTGATGAGTACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATTAAAGGAGAATTATCTGGACATTTTGAAGACCTGCTGCTGGCCATAGTTCATTGTGCGAGGAACACTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



S Y Yu et al.
Neoplasma, 61(3), 257-264 (2014-05-16)
Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric
Qiu-Zhong Pan et al.
Molecular carcinogenesis, 54(8), 598-607 (2014-01-01)
Annexin A3 (ANXA3) has been found to play important roles in cancer progression, metastasis, and drug resistance; however, its role in hepatocellular carcinoma (HCC) remains unknown. In this study, we investigated the expression level, clinical significance and biologic function of
Stryder M Meadows et al.
PloS one, 10(7), e0132580-e0132580 (2015-07-17)
Annexins are a large family of calcium binding proteins that associate with cell membrane phospholipids and are involved in various cellular processes including endocytosis, exocytosis and membrane-cytoskeletal organization. Despite studies on numerous Annexin proteins, the function of Annexin A3 (Anxa3)