Skip to Content
Merck

EMU060801

MISSION® esiRNA

targeting mouse Stk11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGGCCAACGTCAAGAAGGAGATCCAGCTGCTGCGGCGGCTGCGGCATCGGAATGTGATCCAGCTTGTGGACGTGCTGTACAATGAGGAGAAGCAGAAGATGTATATGGTGATGGAGTACTGCGTATGTGGCATGCAGGAGATGCTGGACAGTGTGCCGGAGAAGCGCTTCCCTGTGTGCCAAGCTCATGGGTACTTCCGCCAGCTGATTGACGGCCTGGAATACCTACACAGCCAGGGCATTGTTCACAAGGACATCAAGCCGGGCAACCTGCTACTCACCACCAATGGCACACTCAAGATCTCCGACCTCGGTGTTGCCGAGGCCCTGCACCCTTTCGCTGTGGATGACACCTGCCGGACAAGCCAGGGCTCCCCGGCCTTCCAGCCTCCTGAGATTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Fanny Dupuy et al.
Cancer & metabolism, 1(1), 18-18 (2013-11-28)
Germline and somatic mutations in STK11, the gene encoding the serine/threonine kinase LKB1, are strongly associated with tumorigenesis. While loss of LKB1 expression has been linked to breast cancer, the mechanistic role of LKB1 in regulating breast cancer development, metastasis
Juan Li et al.
Journal of experimental & clinical cancer research : CR, 33, 70-70 (2014-09-03)
LKB1, also known as STK11, is a master kinase that serves as an energy metabolic sensor and is involved in cell polarity regulation. Recent studies have indicated that LKB1 is related to breast tumorigenesis and breast cancer progression. However, little
Ngai Na Co et al.
Cancer, 120(22), 3457-3468 (2014-07-22)
Liver kinase B1 (LKB1) is a serine/threonine kinase that functions as a tumor suppressor and regulates cell polarity, proliferation, and metabolism. Mutations in LKB1 are associated with Peutz-Jeghers syndrome as well as sporadic cervical and lung cancers. Although LKB1-null mice