Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTTGACTTTGCCAAACAGCTCCCTGGCTTCCTACAGCTCAGCAGGGAGGACCAGATCGCCTTGCTGAAGACCTCTGCAATCGAGGTCATGCTTCTGGAGACGTCACGGAGGTACAACCCCGGCAGTGAGAGCATCACCTTCCTCAAGGACTTCAGTTACAACCGGGAAGACTTTGCCAAAGCAGGGCTGCAGGTGGAGTTCATCAACCCCATCTTTGAGTTCTCCAGAGCCATGAATGAGCTGCAACTCAATGATGCTGAGTTTGCTCTGCTCATTGCCATCAGCATCTTCTCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAAGTAGAGAGGCTGCAACACACATATGTGGAGGCCCTGCACGCCTACGTCTCCATCAACCACCCCCACGACCGACTGATGTTCCCACGGATGCTAATGAAGCTGGTGAGCC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... NR1H3(22259), Nr1h3(22259)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported
Limei Zhong et al.
Molecular immunology, 60(1), 32-43 (2014-04-22)
Liver X receptors (LXRs) are nuclear receptors that play an essential role in lipid and cholesterol metabolism. Emerging studies indicate a potential function for LXRs in regulating dendritic cell (DC)-dependent immune responses; however, the role of LXRs in DC differentiation